• Willkommen im Biologie-Forum! Du brauchst Hilfe? In unserem Biologie-Forum kann jeder seine Fragen zur Biologie stellen - und anderen bei Fragen helfen.

primer desing

Aloscita

Einfacher Vertebrat
#1
hi derzeit bin ich dran mir selber beizubringer wie man einen primer desing...

da habe ich die interseite http://fokker.wi.mit.edu/primer3/input.htm endekt und empfohlen bekommen von meiner lehrerin. Als ich sie fragte ob sie mir erklären könne, wie ich mit diesem programm umgehen muss, meinte sie, sie habe keine zeit dafür etc.

Nun wollt ich fragen ob jemand mit diesem programm schon gearbeitet hat und mir erklären kann auf was ich achten muss und was ich überhaupt machen muss.

Was ich weiß:D ist das ich in das erste feld eine nukleotidabfolge in form von fasta eingeben muss. beim rest bin ich verwirrt...

danke und gruß:cool:
 

Joffi

Moderator
Moderator
#2
Grüß Dich!

Ich benutze zum Primerdesign immer Primer3. Zwar ein anderes Interface, aber genau die Software, die auch auf Deiner Seite da läuft.

Prinzipiell kannst Du erst einmal mit den voreingestellten Werten arbeiten.
1. In das oberste, große Feld kopierst Du eine Sequenz, in der irgendwo der Bereich ist, den Du amplifizieren willst. Vergib in dem Feld drunter einen beliebigen Namen dafür.
2. Targets: Wenn Du willst, kannst Du hier ein Target definieren. "Target" heisst, dass die zwei Primer NIEMALS da drin liegen und IMMER einer rechts und einer links davon liegt. Sonst nichts.
3. Excluded regions: Wenn Du willst, kannst Du Regionen definieren, in denen NIEMALS ein Primer liegen darf. Das benutz nur, wenn Du einen guten Grund hast (dir gefällt ein Primer nicht, den das Programm findet und sperrst einfach dessen Bindesequenz z.B.), sonst lass es frei.
4. Product size range: Gib hier ein, wie lang Dein PCR-Produkt sein darf (von-bis in Basenpaaren).

So, den ganzen Rest lässt Du einfach so, dann kriegst Du schon mal vernünftige Primer. Wenn Du damit soweit klar kommst und mehr wissen magst, frag nochmal.

Troubleshooting: Wenn eine Fehlermeldung kommt, liegts fast immer daran, dass Du inkompatible Werte eingestellt hast (z.B. "excluded": 1,50 und dazu "target": 30,5. Das geht halt nicht).
 

Aloscita

Einfacher Vertebrat
#3
was meinen die mit pick left primer und pick right primer und Pick hybridization probe..

meinen die damit bei left primer das von 5'->3' gehen soll oder was sonst?

danke
 

Joffi

Moderator
Moderator
#4
Das Programm dient ja dazu, ein Primerpaar zu erstellen, mit dem man eine bestimmte DNA-Sequenz amplifizieren kann. Man gibt dem Programm also durch diese Häkchen dort den Auftrag "pick left primer" und "pick right primer".
(also "suche mir einen linken und einen rechten Primer"; vergiß die "hybridization probe", das Programm kann auch noch allerlei anderes, was uns jetzt nicht interessiert).
Man kann alternativ auch einen linken Primer vorgeben, wenn man schon einen hat, dann würde man das Häkchen da wegmachen und seine Sequenz in das Fenster pasten.

Zum Output:
Hier ein Beispiel:

OLIGO start len tm gc% any 3' seq
LEFT PRIMER 2047 20 59.98 50.00 6.00 2.00 GCATGCTGATGACTGCTGAT
RIGHT PRIMER 2246 20 60.02 55.00 4.00 3.00 TCCTCTTCCTGTGTGCAGTG
SEQUENCE SIZE: 3520
INCLUDED REGION SIZE: 3520
PRODUCT SIZE: 200, PAIR ANY COMPL: 5.00, PAIR 3' COMPL: 2.00

Start: Die Basenposition gezählt ab der ersten Base, wo der Primer anfängt.
Len: Länge in Bp des Primers
tm: Schmelztemperatur des Primers (wichtig für die Einstellung der Annealing-Temperatur in der PCR).
gc%: prozentualer Anteil der Basen G und C, brauch dich vorläufig nicht zu interessieren.
any & 3`seq: das sind zwei Qualität-Maße. Je höher, umso doof. Es geht darum, ob die Primer streckenweise mit sich selbst oder dem jeweils anderen Primer aufeinander passen. dann bilden sich z.B. Primer-Dimere, die in der PCR unbrauchbar werden.
product size: Der Bereich zwischen den Primern incl. derselben.

P.S.: Bin jetzt zwei Wochen im Urlaub, also nicht böse sein, wenn ab morgen nix mehr kommt :)
 
nach oben